Kretzschmaria deusta
(Hoffm.) P.M.D.Martin
Study description
This study corresponds to the anamorph (asexual or conidial stage) of the species, appearing resupinate and closely appressed to the substrate, velvety, bluish-grey with a whitish growing margin.
Conidiophores densely clustered forming a palisade, hyaline, moderately thick-walled, septate, 30-45 µm long and 3-4 µm wide, with the terminal cell slightly widened.
Conidia cylindric-ellipsoidal, smooth, hyaline, thin-walled, with one end more pointed where attached to the conidiophore and the opposite end rounded, containing small lipid guttules inside.
Herbarium material available: JTP2281/24.
Geographic references
Map generated from global occurrence data from GBIF. GBIF.
Study measurements
Values in Microns (µm)Macroscopic gallery
1 / 5Kretzschmaria deusta - 1 - IMG_8100
Microscopic gallery
1 / 9Kretzschmaria deusta - 10 - Himenio-013
Genetic / Phylogenetic Study
Sequences and Data
Sequencing (Chromatogram)
Select file:
Chromatogram: A11_JTP63_ITS6R__UBM-SAI_.ab1
Extracted sequence:
GATGTCTGGATCTTTTCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTATTCCTACCTGATCCGAGGTCAACCTTATAAAAAATAGGGGGGTGTTTTACGGCAGGGGACCGGCTCATCTCTACAGGCGAGAATAAAATCTTTACTACGCCTAGAGTGTGAACCGACTCCGCCACTAACTTTAAGGAGCTACAGCAAAGAATGCGGTAGGCTCCCAACACTAAGCAACAGAGGCTTAAGGGTTGAAATGACGCTCGAACAGGCATGCCCACTAGAATACTAATGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTAAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTAACTTAATTTCCATATAATGATTCAGAATACCATTTACTAAACAGAATTTGTTTTTCAGTCCACCGGCAGGTGGCACCGCATCTCTCTACCGGGTAGGTCTCTCCGGGTAGTACCTTCCCCTGTAAGGTACTATAGGATAGGGTCCTACAGGGTAGCAAGATGCGACCTGCCTGCCGAGGCAACAGAAGGTAAGTTCACATGGGTTTAGGAGTTGTAACAAACTCTTTAATGATCCCTCCGCTGGTTCACCTACGGAAACCTGGTTTACGACTA