Lyomyces mascarensis
Riebesehl, Yurch. & Langer
Study description
General: Tropical corticioid species, basidiomata pure white, completely resupinate, surface farinaceous to granulose, margin diffuse and poorly delimited.
Hyphal system: Monomitic; subhymenial and subicular hyphae cylindrical, hyaline, thin-walled, 2.5-3.5 µm wide, densely compacted and interwoven, septate with prominent clamp connections.
Crystals: In the hymenium and subhymenium, distinctive star-shaped (stellate) crystals measuring 10-12 µm in diameter are regularly scattered.
Cystidia: Scarce, fusiform with pointed apices, 15-30 x 3-5 µm.
Basidia: Cylindrical to utriform, 15-28 x 3.5-5 µm, with basal clamp connections, 4-spored.
Spores: Ellipsoid, smooth, hyaline, thin-walled, 6-7 x 3.5-5 µm, with an eccentric apiculus and a large oil drop, inamyloid in Melzer's reagent.
Herbarium voucher: JTP2633/25.
Hyphal system: Monomitic; subhymenial and subicular hyphae cylindrical, hyaline, thin-walled, 2.5-3.5 µm wide, densely compacted and interwoven, septate with prominent clamp connections.
Crystals: In the hymenium and subhymenium, distinctive star-shaped (stellate) crystals measuring 10-12 µm in diameter are regularly scattered.
Cystidia: Scarce, fusiform with pointed apices, 15-30 x 3-5 µm.
Basidia: Cylindrical to utriform, 15-28 x 3.5-5 µm, with basal clamp connections, 4-spored.
Spores: Ellipsoid, smooth, hyaline, thin-walled, 6-7 x 3.5-5 µm, with an eccentric apiculus and a large oil drop, inamyloid in Melzer's reagent.
Herbarium voucher: JTP2633/25.
Geographic references
Map generated from global occurrence data from GBIF. GBIF.
Study measurements
Values in Microns (µm)Macroscopic gallery
1 / 4Lyomyces mascarensis - 1 - IMG_8566
Microscopic gallery
1 / 12Lyomyces mascarensis - 10 - Basidios-002
Genetic / Phylogenetic Study
Phylogenetic Tree
Árbol .JPG
Sequences and Data
Sequencing (Chromatogram)
Chromatogram: C12_JTP16_ITS4_(UBM-SAI).ab1
Extracted sequence:
TACCATGGTTGAGAAGCCGAACGTCATTACAAGCTATGGCAGTGAAGATATTATCACACGCACACGTAGCGTTGCAACTCGATTCAACTAATGCATTCAAGAGAAGCCAATCGTAAGACCAGCAGTCTCCAAATCCAATCCAGCATCACAAAAGCAATGTTAGATTGATGATTACAAGACACTCAAACAGGCATACTCCTCGGAATACCAAGGAGTGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGTTGAAAGTTGTATTAGATTAAGCCCTTAGGCTAGTTACATTCTACAAGACTTCAAATTGGTTTGTGATAATGGGCAAAGCAAAGTCCCAGCAGTCTCATTACAAGACCGCAGCTCCCATGACGGAGGACTTCAACTTTGAAAGTGCACAGGTGTTGAATGGATTGAGTAGAGCTGAGCACATGTCCGCCAGAGCAGACCAGCATCAAAGTCCTGTTCAAACTCATTAAATGATCCTTCCGAGGGGTTCACCTACGGAAACCTTGTTAACGACTTTTACTTCCCAAAGGGGGAAAAAAAA