Lyomyces crustosus
(Pers.) P.Karst.
Study description
General: Spring corticioid fungus developing on fallen branches of deciduous trees (also found on conifer wood), basidiomata resupinate, white to pale ochre, surface odontoid with short teeth.
Hyphal system: Monomitic; subicular hyphae hyaline, moderately thick-walled, 2-3.5 µm wide, septate with clamp connections.
Cystidia: Leptocystidia-like hyphal terminations present, thin-walled, fusiform, emergent above basidia, with basal clamp connections.
Basidia: Cylindric-clavate, 20-28 x 3-4.5 µm, with basal clamp connections, 4-spored.
Spores: Ellipsoid, smooth, hyaline, thin-walled, 5-6.5 x 3-3.5 µm, with an inconspicuous eccentric apiculus, containing a large oil guttule, inamyloid in Melzer's reagent.
Herbarium voucher: JTP2151/24.
Hyphal system: Monomitic; subicular hyphae hyaline, moderately thick-walled, 2-3.5 µm wide, septate with clamp connections.
Cystidia: Leptocystidia-like hyphal terminations present, thin-walled, fusiform, emergent above basidia, with basal clamp connections.
Basidia: Cylindric-clavate, 20-28 x 3-4.5 µm, with basal clamp connections, 4-spored.
Spores: Ellipsoid, smooth, hyaline, thin-walled, 5-6.5 x 3-3.5 µm, with an inconspicuous eccentric apiculus, containing a large oil guttule, inamyloid in Melzer's reagent.
Herbarium voucher: JTP2151/24.
Geographic references
Map generated from global occurrence data from GBIF. GBIF.
Study measurements
Values in Microns (µm)Macroscopic gallery
1 / 12Lyomyces crustosus - 1 - IMG_6411
Microscopic gallery
1 / 32Lyomyces crustosus - 10 - Basidios-003
Genetic / Phylogenetic Study
Sequences and Data
Sequencing (Chromatogram)
Chromatogram: A5+29578_1F+ITS4.ab1
Extracted sequence:
AGGCCTNGAAAGGAAACCNGNCCGCTTTAAGGTGAATATTGCTCAAAGCGCTGTCCAAGTTCGAAGGACCATTAGAAGCTGATTTCAACAAGAGCAATACAGTGAAGATATTATCACACCGCATATACGCTGCTTGTAAGACTTCAGCTAATGCATTTGAGGGAAGCCAATTCAGCATTAGAACCAGCAAGTCCCCAAGTCCAATTCAACAACGACCATTACAGAAGTTGAGAATTGATGATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGTTGAAAGTTGTATTATGTTAAGCCATCAAAGGCCATTAGACATTCTACAAGACATTATACAGAGTTTATGAATGTATGGGCAAAGGTGCAGCCCCAGCGATCATTACAATCACGGCTCCCATTACGGAGGACTACAGAGCTTTGAAAGTGCACAGGTGTAATGTGGATTTGACGGAAACCGAGCACATGCAGCATTACACTGCCAGCATCAAGTCTCACTTGCAAATTCATGTATTGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCTCTAAATGACCAAGAA