Leucogyrophana sororia
(Burt) Ginns
Study description
General: Completely resupinate basidioma, pale cream with a whitish margin, easily peeling from substrate, with a merulioid hymenophore, developing on decaying fallen pine wood.
Hyphal system: Monomitic; subhymenial generative hyphae cylindrical, hyaline, thin-walled, 2-4 µm wide, densely interwoven, branched, septate with clamp connections. Subicular hyphae slightly thick-walled, 4-7 µm wide, compacted, non-gelatinized.
Basidia: Clavate, small, 15-24 x 4.5-6.5 µm, with basal clamp connections, 4-spored.
Spores: Ellipsoid, smooth, hyaline, thin-walled, 3.6-4.6 x 2-3.2 µm, apiculus minute, indextrinoid/inamyloid in Melzer's reagent.
Hyphal system: Monomitic; subhymenial generative hyphae cylindrical, hyaline, thin-walled, 2-4 µm wide, densely interwoven, branched, septate with clamp connections. Subicular hyphae slightly thick-walled, 4-7 µm wide, compacted, non-gelatinized.
Basidia: Clavate, small, 15-24 x 4.5-6.5 µm, with basal clamp connections, 4-spored.
Spores: Ellipsoid, smooth, hyaline, thin-walled, 3.6-4.6 x 2-3.2 µm, apiculus minute, indextrinoid/inamyloid in Melzer's reagent.
Geographic references
Map generated from global occurrence data from GBIF. GBIF.
Study measurements
Values in Microns (µm)Macroscopic gallery
1 / 6Leucogyrophana sororia - 1 - IMG_5431
Microscopic gallery
1 / 11Leucogyrophana sororia - 10 - Hifas subiculares 2
Genetic / Phylogenetic Study
Sequences and Data
Sequencing (Chromatogram)
Chromatogram: D5+26384_1F+ITS4.ab1
Extracted sequence:
CACGGGAATCCAACCTGATTTGAGGTCAAGGTTTCAGGGGTGGGTCAGAAACATCTTACCCGCGAGGGCAAGACGAACTTCGCCTGGCTATGAGCCAGAGTCCTTTGTCTCTCAGAGCACGGCGATCATTATCACACCGAGTCCAACAAGAGACCACGAAATCCAGCTAATGCTATTCAGAGGAGTCGTGCTCCTTAAGAGCCGACAGACCCCCACAGTCCAAGCCCATTCCACCGCAAAGGTGTTAGGGTTGAGAATTCAAATGACGCTCAAACAGGCATGCTCCTTGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACGGTAAATCTGCAATTCACATTACATATCGCAATTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCACTGCTGAAAGTTATGATTTTCATTCGTTATGATCAACAACATTCTATAGACATTCATAGGAGCATGACAAATAGGCAGGCCCCTCGGCCTTTCGACCGAGAAACCTACCGATGGGTGCACAGGTGAGGTTGAAGACGCGATCGAGGCGTGCACATGCCCGTCAGAAGACGGACCAGCGACAGCCCCTCTCGCTCTGTGAATCGATAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCTCAAAGGGAAACCAAGAAA